Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4488139
End position: 4488162
Length: 24

DNA sequence
>NC_013739, from 4488139 to 4488162 (24 bp); Conexibacter woesei DSM 14684 GCCGCCGCCGACGCCGCTGCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4486769-4488409	Sequence	Cwoe_4226 - glucose-methanol-choline oxidoreductase (Protein is coded in complementary strand; from 4488409 to 4486769)