Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4586154
End position: 4586207
Length: 54

DNA sequence
>NC_013739, from 4586154 to 4586207 (54 bp); Conexibacter woesei DSM 14684 CGCCCCAGCCGCGCCGCCCGCCCCAGCCGCGCCGCCCGCCCCAGCCGCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4585798-4586484	Sequence	Cwoe_4310 - molybdenum hydroxylase accessory protein, YgfJ family (Protein is coded in complementary strand; from 4586484 to 4585798)