Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4602736
End position: 4602760
Length: 25

DNA sequence
>NC_013739, from 4602736 to 4602760 (25 bp); Conexibacter woesei DSM 14684 GCGCGGCGCCGGGCGCCGCGTCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4602159-4602950	Sequence	Cwoe_4321 - short-chain dehydrogenase/reductase SDR (Protein is coded in complementary strand; from 4602950 to 4602159)