Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4608182
End position: 4608226
Length: 45

DNA sequence
>NC_013739, from 4608182 to 4608226 (45 bp); Conexibacter woesei DSM 14684 CCGCCGCCGCGCCGACCGCCGCCTCGCAGTCGGCAGCCGCGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4607626-4608420	Sequence	Cwoe_4326 - short-chain dehydrogenase/reductase SDR (Protein is coded in complementary strand; from 4608420 to 4607626)