Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 471268
End position: 471291
Length: 24

DNA sequence
>NC_013739, from 471268 to 471291 (24 bp); Conexibacter woesei DSM 14684 CGATCGCGATCACGGTCGCGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 470842-471720	Sequence	Cwoe_0455 - binding-protein-dependent transporters inner membrane component