Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4775747
End position: 4775770
Length: 24

DNA sequence
>NC_013739, from 4775747 to 4775770 (24 bp); Conexibacter woesei DSM 14684 CGATCGCGAACGCGAACGGGATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4774117-4776318	Sequence	Cwoe_4478 - cytochrome C assembly protein (Protein is coded in complementary strand; from 4776318 to 4774117)