Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4808345
End position: 4808371
Length: 27

DNA sequence
>NC_013739, from 4808345 to 4808371 (27 bp); Conexibacter woesei DSM 14684 GCCGCCGGCACCGCCGGCACCGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4807104-4808609	Sequence	Cwoe_4507 - integral membrane sensor signal transduction histidine kinase (Protein is coded in complementary strand; from 4808609 to 4807104)