Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4810448
End position: 4810474
Length: 27

DNA sequence
>NC_013739, from 4810448 to 4810474 (27 bp); Conexibacter woesei DSM 14684 CCGCCGGCACCGCCGCCACCGCCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4809362-4811329	Sequence	Cwoe_4509 - glycosyl transferase family protein (Protein is coded in complementary strand; from 4811329 to 4809362)