Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4831778
End position: 4831801
Length: 24

DNA sequence
>NC_013739, from 4831778 to 4831801 (24 bp); Conexibacter woesei DSM 14684 CACCCGCACCCGCACCCGCACCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4830460-4832049	Sequence	Cwoe_4531 - GntR family transcriptional regulator (Protein is coded in complementary strand; from 4832049 to 4830460)