Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4899720
End position: 4899773
Length: 54

DNA sequence
>NC_013739, from 4899720 to 4899773 (54 bp); Conexibacter woesei DSM 14684 CAGTCGTCGTCGCCGCCGGAGTCGTCGCCGCCGCCCGAGTCGTCTTCGCCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4899720-4901324	Sequence	Cwoe_4597 - ECF subfamily RNA polymerase sigma-24 subunit (Protein is coded in complementary strand; from 4901324 to 4899720)