Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4915882
End position: 4915905
Length: 24

DNA sequence
>NC_013739, from 4915882 to 4915905 (24 bp); Conexibacter woesei DSM 14684 CGATGTCGATCTCGTTGTCGAAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4915506-4916957	Sequence	Cwoe_4610 - adenosylhomocysteinase (Protein is coded in complementary strand; from 4916957 to 4915506)