Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4958399
End position: 4958443
Length: 45

DNA sequence
>NC_013739, from 4958399 to 4958443 (45 bp); Conexibacter woesei DSM 14684 GCCGCGCCGGGCGCCGCCGCTCCTGGAGCCGCCGAGCCGGGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4958357-4959595	Sequence	Cwoe_4656 - FAD dependent oxidoreductase (Protein is coded in complementary strand; from 4959595 to 4958357)