Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 4976189
End position: 4976212
Length: 24

DNA sequence
>NC_013739, from 4976189 to 4976212 (24 bp); Conexibacter woesei DSM 14684 CGGCGCCGGTGCCGGTGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4975348-4976910	Sequence	Cwoe_4667 - cell division protein FtsZ (Protein is coded in complementary strand; from 4976910 to 4975348)