Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5020670
End position: 5020693
Length: 24

DNA sequence
>NC_013739, from 5020670 to 5020693 (24 bp); Conexibacter woesei DSM 14684 GCCGCCGTCGCCGGCGCCGCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5018576-5020762	Sequence	Cwoe_4706 - hypothetical protein (Protein is coded in complementary strand; from 5020762 to 5018576)