Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5057953
End position: 5057976
Length: 24

DNA sequence
>NC_013739, from 5057953 to 5057976 (24 bp); Conexibacter woesei DSM 14684 TAGTGGTCGTGGTCGTGGTGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 5057123-5057953	Sequence	Cwoe_4739 - ABC transporter (Protein is coded in complementary strand; from 5057953 to 5057123)
ORF. 5057953-5058714	Sequence	Cwoe_4740 - ABC transporter (Protein is coded in complementary strand; from 5058714 to 5057953)