Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5084626
End position: 5084652
Length: 27

DNA sequence
>NC_013739, from 5084626 to 5084652 (27 bp); Conexibacter woesei DSM 14684 CTTCTGCCGCCTCTGCCGCCTCTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5084596-5086602	Sequence	Cwoe_4763 - hypothetical protein (Protein is coded in complementary strand; from 5086602 to 5084596)