Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5173129
End position: 5173158
Length: 30

DNA sequence
>NC_013739, from 5173129 to 5173158 (30 bp); Conexibacter woesei DSM 14684 CTCTGCCTCTCCCTCTGCTTCTGCTTCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5172936-5173886	Sequence	Cwoe_4852 - hypothetical protein (Protein is coded in complementary strand; from 5173886 to 5172936)