Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5174242
End position: 5174265
Length: 24

DNA sequence
>NC_013739, from 5174242 to 5174265 (24 bp); Conexibacter woesei DSM 14684 CCGCCGCCGTCGCCGCCGTCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5173987-5174727	Sequence	Cwoe_4853 - hypothetical protein (Protein is coded in complementary strand; from 5174727 to 5173987)