Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5251493
End position: 5251516
Length: 24

DNA sequence
>NC_013739, from 5251493 to 5251516 (24 bp); Conexibacter woesei DSM 14684 CGCGAGCGCCAGCGCGACCGCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5250321-5251748	Sequence	Cwoe_4923 - amino acid permease (Protein is coded in complementary strand; from 5251748 to 5250321)