Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5296723
End position: 5296746
Length: 24

DNA sequence
>NC_013739, from 5296723 to 5296746 (24 bp); Conexibacter woesei DSM 14684 TCGCGGTCGCCGTCGCCGTCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5294925-5296904	Sequence	Cwoe_4965 - hypothetical protein (Protein is coded in complementary strand; from 5296904 to 5294925)