Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5311315
End position: 5311368
Length: 54

DNA sequence
>NC_013739, from 5311315 to 5311368 (54 bp); Conexibacter woesei DSM 14684 CGGCCGCAGCGCCGTGCGAGTCCGCGGCGCCGTGCGAGTCCGCGGCGCCGTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5310438-5311994	Sequence	Cwoe_4981 - major facilitator superfamily protein (Protein is coded in complementary strand; from 5311994 to 5310438)