Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5361164
End position: 5361187
Length: 24

DNA sequence
>NC_013739, from 5361164 to 5361187 (24 bp); Conexibacter woesei DSM 14684 CGCGAGCGCCAGCGCGACCGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5360163-5361317	Sequence	Cwoe_5029 - signal transduction histidine kinase (Protein is coded in complementary strand; from 5361317 to 5360163)