Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5363731
End position: 5363790
Length: 60

DNA sequence
>NC_013739, from 5363731 to 5363790 (60 bp); Conexibacter woesei DSM 14684 CGGGCGGCGCTGGCGCGGGCGGCGCTGGCGCGGGCGGCGCTGGCGCGGGCGGCGCTGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5362894-5364243	Sequence	Cwoe_5031 - cytochrome d ubiquinol oxidase subunit II