Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 539155
End position: 539178
Length: 24

DNA sequence
>NC_013739, from 539155 to 539178 (24 bp); Conexibacter woesei DSM 14684 CGCCGCCGCCACCGCCGCCACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 536556-539642	Sequence	Cwoe_0517 - Ig domain-containing protein group 1 domain-containing protein (Protein is coded in complementary strand; from 539642 to 536556)