Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5409799
End position: 5409834
Length: 36

DNA sequence
>NC_013739, from 5409799 to 5409834 (36 bp); Conexibacter woesei DSM 14684 CGCCGGTCTCGCCGGTCTCGCCGGTCTCGCCGGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5406948-5410166	Sequence	Cwoe_5059 - hypothetical protein (Protein is coded in complementary strand; from 5410166 to 5406948)