Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 546477
End position: 546500
Length: 24

DNA sequence
>NC_013739, from 546477 to 546500 (24 bp); Conexibacter woesei DSM 14684 GCCGAGACCGAGGCCGTGGCCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 546310-547506	Sequence	Cwoe_0525 - peptidase M24 (Protein is coded in complementary strand; from 547506 to 546310)