Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5506094
End position: 5506147
Length: 54

DNA sequence
>NC_013739, from 5506094 to 5506147 (54 bp); Conexibacter woesei DSM 14684 GCGGCTTCGTGACGATCGGAAGCTTCGTGACGACCGGCGGCTTGGTGACGACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5505784-5508474	Sequence	Cwoe_5148 - hypothetical protein (Protein is coded in complementary strand; from 5508474 to 5505784)