Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5509010
End position: 5509054
Length: 45

DNA sequence
>NC_013739, from 5509010 to 5509054 (45 bp); Conexibacter woesei DSM 14684 CGGAGTCGATCTCGACGGCGTCGATCTCGACGGAGCGGATTTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5508546-5509541	Sequence	Cwoe_5149 - hypothetical protein (Protein is coded in complementary strand; from 5509541 to 5508546)