Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5523454
End position: 5523483
Length: 30

DNA sequence
>NC_013739, from 5523454 to 5523483 (30 bp); Conexibacter woesei DSM 14684 CGGGTCCAGGTCCAGGTCCGGGTCCGGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5522988-5525228	Sequence	Cwoe_5163 - hypothetical protein (Protein is coded in complementary strand; from 5525228 to 5522988)