Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5539074
End position: 5539097
Length: 24

DNA sequence
>NC_013739, from 5539074 to 5539097 (24 bp); Conexibacter woesei DSM 14684 GCCGCGCCCGCGGCCGAGGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5539027-5540580	Sequence	Cwoe_5171 - D-alanyl-D-alaninecarboxypeptidase/D-alanyl-D-alanine-endopeptidase