Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5583393
End position: 5583446
Length: 54

DNA sequence
>NC_013739, from 5583393 to 5583446 (54 bp); Conexibacter woesei DSM 14684 CGCCGCCCGCCGCCGCGCCGCCACTCGCCGGCGCGCCGCCGGCCGCCGCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5582828-5585710	Sequence	Cwoe_5220 - LuxR family transcriptional regulator (Protein is coded in complementary strand; from 5585710 to 5582828)