Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5600268
End position: 5600291
Length: 24

DNA sequence
>NC_013739, from 5600268 to 5600291 (24 bp); Conexibacter woesei DSM 14684 CGGCGTCGCCGTCGGCCTCGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5600009-5600836	Sequence	Cwoe_5239 - MazG family protein (Protein is coded in complementary strand; from 5600836 to 5600009)