Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 561950
End position: 561973
Length: 24

DNA sequence
>NC_013739, from 561950 to 561973 (24 bp); Conexibacter woesei DSM 14684 CAGCGCCAGAGCCAGGGCCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 561357-562283	Sequence	Cwoe_0537 - D-isomer specific 2-hydroxyacid dehydrogenase NAD-binding protein (Protein is coded in complementary strand; from 562283 to 561357)