Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 564731
End position: 564784
Length: 54

DNA sequence
>NC_013739, from 564731 to 564784 (54 bp); Conexibacter woesei DSM 14684 CCGCCGCCGCTCGAACCGCCGCCGCCGCTCGAACCGCCGCCGCCGCTCGAACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 564338-567523	Sequence	Cwoe_0540 - hypothetical protein (Protein is coded in complementary strand; from 567523 to 564338)