Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5665658
End position: 5665711
Length: 54

DNA sequence
>NC_013739, from 5665658 to 5665711 (54 bp); Conexibacter woesei DSM 14684 GCCGTAAGGCGCGCTACGGCCGCACGGCGCGCTACCGCCGCACGGCGCGCTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 5664196-5665665	Sequence	Cwoe_5300 - D-glucuronyl C5-epimerase domain-containing protein
ORF... 5665690-5666508	Sequence	Cwoe_5301 - polysaccharide deacetylase (Protein is coded in complementary strand; from 5666508 to 5665690)