Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5667123
End position: 5667146
Length: 24

DNA sequence
>NC_013739, from 5667123 to 5667146 (24 bp); Conexibacter woesei DSM 14684 GCGACGGCGCCGGCGGCGGAGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5666505-5667560	Sequence	Cwoe_5302 - group 1 glycosyl transferase (Protein is coded in complementary strand; from 5667560 to 5666505)