Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5677019
End position: 5677054
Length: 36

DNA sequence
>NC_013739, from 5677019 to 5677054 (36 bp); Conexibacter woesei DSM 14684 GGCGTGGTGGGCGTGGTGGGCGTGGTGGGCGTGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5676104-5677516	Sequence	Cwoe_5310 - hypothetical protein (Protein is coded in complementary strand; from 5677516 to 5676104)