Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5730424
End position: 5730447
Length: 24

DNA sequence
>NC_013739, from 5730424 to 5730447 (24 bp); Conexibacter woesei DSM 14684 TCGCCGTCGCAGCCGCCGTCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5730385-5731857	Sequence	Cwoe_5353 - peptidase S8/S53 subtilisin kexin sedolisin