Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5750135
End position: 5750188
Length: 54

DNA sequence
>NC_013739, from 5750135 to 5750188 (54 bp); Conexibacter woesei DSM 14684 TGCGGCGGCGTGCGGCGGGGCGGCGGCGCGCGGCGGGGCGGTGGCGAGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5749506-5750696	Sequence	Cwoe_5376 - Arsenical pump membrane protein (Protein is coded in complementary strand; from 5750696 to 5749506)