Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5822288
End position: 5822341
Length: 54

DNA sequence
>NC_013739, from 5822288 to 5822341 (54 bp); Conexibacter woesei DSM 14684 GGGGCCCTGCGGGCCGACGGGACCCTGCGCGCCGGCGGGACCCTGCGGGCCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5822001-5825216	Sequence	Cwoe_5445 - LmbE family protein (Protein is coded in complementary strand; from 5825216 to 5822001)