Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5945040
End position: 5945063
Length: 24

DNA sequence
>NC_013739, from 5945040 to 5945063 (24 bp); Conexibacter woesei DSM 14684 TTGACCTTGATCATGACCATGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5944632-5945069	Sequence	Cwoe_5551 - hypothetical protein (Protein is coded in complementary strand; from 5945069 to 5944632)