Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5951473
End position: 5951497
Length: 25

DNA sequence
>NC_013739, from 5951473 to 5951497 (25 bp); Conexibacter woesei DSM 14684 CGCGCCGCGTTGCGCAGCGCCTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5951230-5952483	Sequence	Cwoe_5558 - Signal transduction histidine kinase-like protein (Protein is coded in complementary strand; from 5952483 to 5951230)