Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5959970
End position: 5959999
Length: 30

DNA sequence
>NC_013739, from 5959970 to 5959999 (30 bp); Conexibacter woesei DSM 14684 GAGGCGGCGCGTGGCGGCGAGCGGCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5959812-5960873	Sequence	Cwoe_5568 - threonine aldolase (Protein is coded in complementary strand; from 5960873 to 5959812)