Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5969983
End position: 5970018
Length: 36

DNA sequence
>NC_013739, from 5969983 to 5970018 (36 bp); Conexibacter woesei DSM 14684 CGATCAGGTGGCAGAGCAGGTGGCAGAGCAGGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 5969987-5970256	Sequence	Cwoe_5576 - hypothetical protein (Protein is coded in complementary strand; from 5970256 to 5969987)