Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 5989494
End position: 5989517
Length: 24

DNA sequence
>NC_013739, from 5989494 to 5989517 (24 bp); Conexibacter woesei DSM 14684 ATCCCGAACCCGATCCCGATCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5989128-5990627	Sequence	Cwoe_5593 - major facilitator superfamily protein (Protein is coded in complementary strand; from 5990627 to 5989128)