Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 6019324
End position: 6019350
Length: 27

DNA sequence
>NC_013739, from 6019324 to 6019350 (27 bp); Conexibacter woesei DSM 14684 CGGCGATCGCGGCGATCGCGGCGATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6018255-6020786	Sequence	Cwoe_5621 - hypothetical protein (Protein is coded in complementary strand; from 6020786 to 6018255)