Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 6053683
End position: 6053706
Length: 24

DNA sequence
>NC_013739, from 6053683 to 6053706 (24 bp); Conexibacter woesei DSM 14684 GGCGACGGCGAGGTCGACGGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6053084-6053863	Sequence	Cwoe_5651 - short-chain dehydrogenase/reductase SDR (Protein is coded in complementary strand; from 6053863 to 6053084)