Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 6083187
End position: 6083216
Length: 30

DNA sequence
>NC_013739, from 6083187 to 6083216 (30 bp); Conexibacter woesei DSM 14684 TCGGCGCCGGCGTCGACGGCGGCGTCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6081237-6083387	Sequence	Cwoe_5681 - hypothetical protein (Protein is coded in complementary strand; from 6083387 to 6081237)