Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 6091968
End position: 6092003
Length: 36

DNA sequence
>NC_013739, from 6091968 to 6092003 (36 bp); Conexibacter woesei DSM 14684 GGCCGTCGCCGGTGCCGTTGCCGGCGCCGTCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6091961-6092596	Sequence	Cwoe_5693 - TetR family transcriptional regulator (Protein is coded in complementary strand; from 6092596 to 6091961)