Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 6112883
End position: 6112906
Length: 24

DNA sequence
>NC_013739, from 6112883 to 6112906 (24 bp); Conexibacter woesei DSM 14684 ACGCCGAGGCCGATGCCGACGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6112298-6113239	Sequence	Cwoe_5710 - binding-protein-dependent transporters inner membrane component (Protein is coded in complementary strand; from 6113239 to 6112298)